Vissza a tartalomjegyzékhez
 
BEVEZETÕ TANULMÁNY

Humán calicivírus-fertõzés elsõ magyarországi igazolása

Reuter Gábor dr.1, 2, Kátai Andrea dr.3, Kálmán Mária dr.3 és Szûcs György dr.1
Állami Népegészségügyi és Tisztiorvosi Szolgálat Baranya Megyei Intézete, Pécs, Regionális Virológiai Laboratórium (igazgató: Antal Ilona dr.)1
Pécsi Tudományegyetem, Általános Orvostudományi Kar, Orvosi Mikrobiológiai és Immunitástani Intézet (intézetvezetõ: Emõdy Levente dr.)2
Állami Népegészségügyi és Tisztiorvosi Szolgálat Csongrád Megyei Intézete, Szeged, Laboratóriumi Osztály (igazgató: Zimányi Mária dr.)3
 

A humán calicivírusok (HuCV) az akut virális eredetû gastroenteritisek gyakori kórokozói világszerte, életkortól függetlenül. A szerzõk célja az volt, hogy a HuCV-ok közvetlen kimutatásával bizonyítsák a vírus magyarországi elõfordulását és kóroki szerepét. Az 1998 november végén Szegeden és Algyõn lezajlott óvodai-általános iskolai ételfertõzésként regisztrált gastroenteritis-járványból kapott székletminták mindegyikébõl sikerült reverz transzkripció-polimeráz láncreakció (RT–PCR) segítségével a vírust kimutatni. Ez az elsõ molekuláris virológiai módszerrel igazolt HuCV-okozta élelmiszer eredetû gastroenteritis-járvány Magyarországon. 

Kulcsszavak: humán calicivírus, gastroenteritis, reverz transzkripció polimeráz láncreakció

First detection of human calicivirus infection in Hungary

Human caliciviruses (HuCVs) are important pathogens all over the world. They cause acute non-bacterial gastroenteritis in humans in all age-groups. The aim of the study was to detect HuCV infection in Hungary. Stool samples examined were received from a food-borne outbreak in nursery and elementary school in Szeged and Algyõ areas November 1998. Reverse transcription-polymerase chain reaction (RT–PCR) method was successfully used for the detection of HuCVs in all stool samples received. This is the first description of HuCVs in Hungary and the verification of them as causative agents in a food-borne outbreak. 

Key words: human calicivirus, gastroenteritis, reverse transcription polymerase chain reaction 

Rövidítések: RT–PCR = reverz transzkripció-polimeráz láncreakció (reverse transcription-polymerase chain reaction); HuCV = humán calicivírus; NLVs = Norwalk-szerû vírusok (Norwalk-like viruses); SRSVs = kis kerek-struktúrált vírusok (Small Round-Structured Viruses); SLVs = Sapporo-szerû vírusok (Sapporo-like viruses); ORF = open reading frame

„Winter vomiting disease” (hyperemesis hiemis) néven már 1929-ben John Zahorsky leírta a nem bakteriális, járványos gastroenteritist (3, 11), de a humán calicivírust mint etiológiai ágenst, csak 1969-ben fedezte fel Adler és Zickl az amerikai Ohio állambeli Norwalk város egyik iskolájában 1968-ban lezajlott járvány során laboratóriumba küldött székletmintákban (9). Mai tudásunk szerint, azokban az országokban, ahol már vizsgálták a humán calicivírusok elõfordulását, a virális gastroenteritisek 30–40%-át ezek a vírusok okozták (1). A fertõzés forrása és a terjedési mód elsõsorban a fertõzött széklettel kontaminált víz és étel, illetve a közvetlen kontaktus, de leírtak aeroszollal átvitt fertõzést is (1, 6, 11). Gyakran elõfordul idõlegesen zárt emberi közösségekben (tengeri hajóutak óceánjárói, éttermek, kórházak, iskolák, öregek otthonai, laktanyák), ahová bekerülve gyorsan terjed és rövid idõ alatt nagyszámú megbetegedést okozhat (12). A humán calicivírusok a Caliciviridae családba tartoznak a csak állati megbetegedéseket okozó vírusokat tartalmazó további két, a Vesi- és Lagovírusok alcsoportjaival együtt (2) (1. ábra). A vírusok genetikai információja alapján a HuCV-ok két nagy, a Norwalk-szerû vírusok („Norwalk-like viruses”, NLVs) és a Sapporo-szerû ágensek („Sapporo-like viruses”, SLVs) nemzetségébe sorolhatók (7). A NLV-oknak vagy más nevükön „kis kerek-struktúrált vírusoknak” (SRSVs) két genocsoportja van (GI és GII), melyek két fõ képviselõje a Norwalk, illetve a Snow Mountain vírus (4, 15). Az SLV-ok egy genocsoportjának (GIII) névadó fõ prototípusa a Sapporo vírus. A kapszid gén diverzitása miatt mindkét genusba számos vírus tartozik, melyek száma napjainkban is folyamatosan bõvül (12). Az új típusokat általában  felfedezésük földrajzi helyérõl nevezik el (15). A HuCV-ok 27–40 nm átmérõjû, ikozahedrális szimmetriájú, burok nélküli partikulák, melyek pozitív, egyszálú, kb. 7,4–7,7 kilobázis hosszúságú RNS-genomot tartalmaznak 3 „open reading frame” (ORF) szekvenciával (11, 13). Az ORF1-ben található egy nagyfokban konzervatív régió, mely az RNS-függõ RNS-polimerázt kódolja (11). A NLV-ok nem, de a tipikus vagy klasszikus calicivírusok (SLVs) virionjai, jellegzetes 32 darabból álló, kehely alakú depressziót mutató felszíni struktúrával és 10 kinyúló tüskével rendelkeznek (Dávid csillag) elektronmikroszkópos képeken (8). Innen kapta a víruscsalád a calici nevet (calyx, latinul: kehely, kupa). A humán calicivírus-fertõzést jól körülhatárolható epidemiológiai és klinikai tünettani kritériumok jellemzik: a már említett fertõzési forrásokon és módokon kívül az infekcióknak nincs merev szezonalitása (leggyakoribb mégis a téli hónapokban; erre utal J. Zahorsky megfigyelése is), nincs kifejezett kordependenciája (a NLV-ok egyaránt okoznak gyermekek és felnõttek között is sporadikus és járványos gastroenteritist, míg a SLV-ok esetén, fõleg a kisgyermekek és az idõsek betegednek meg) (7). A humán calicivírusok nagy genetikai diverzitása és a rövidtávú immunitás miatt gyakori a reinfekció, jellemzõ a 24–48 órás inkubációs idõ, hányás (25–100%), hõemelkedés vagy láz (13–71%), diarrhoea, hányinger, hasi görcs, fájdalom vagy diszkomfortérzés és a rövid, 12–60 órás lefolyási idõ (6). A gyanút erõsíti a széklet negatív bakteriális tenyésztési eredménye.
 
1. ábra: A Calicivírusok családja 

NLVs = Norwalk-like viruses (Small Round-Structured Viruses, SRSVs); SLVs = Sapporo-like viruses; G: genogroup (A hepatitis E vírust [HEV] kiemelték a CV-ok közül 1998-ban „bizonytalan besorolási hely” megjelöléssel) 

A humán calicivírusok a hagyományos rutin virológiai módszerekkel nem vizsgálhatók, szövettenyészetben, kísérleti állatban nem szaporíthatók. A kevéssé érzékeny és korlátozott elektronmikroszkópos vizsgálati lehetõség mellett kimutatásuk jelenleg csak molekuláris biológiai módszerekkel lehetséges. A calicivírus-kutatásban élenjáró országokban (USA, Anglia, Japán) már komoly tapasztalatok és eredmények gyûltek össze a HuCV-ok RT–PCR módszerrel történõ azonosításában. Ugyanakkor, fontossá vált, hogy eddig nem vizsgált földrajzi régiókban is feltérképezésre kerüljenek a cirkuláló vírustörzsek. Ezért tûztük ki célul a humán calicivírusok kimutatásának – a lehetõségekhez mért – hazai megteremtését. Ebben a közleményben az elsõ sikeres HuCV-kimutatásról számolunk be, ahol a vírusok egy élelmiszer-eredetû járvány okaként szerepelhettek.

Anyag és módszer

Székletminták

A Szegeden és Algyõn 1998 november végén lezajlott gastroenteritis-járványból öt székletminta állt vizsgálati anyagként rendelkezésünkre. A mintákban az ÁNTSZ Csongrád Megyei Intézete laboratóriumaiban, Szegeden, rutin bakteriológiai és virológiai módszerekkel kórokozó baktériumokat, rota-, adeno- és enterovírust elõzõleg nem találtak. A minták „Norwalk vírus” kimutatása céljából az ÁNTSZ Baranya Megyei Intézete Regionális Virológiai Laboratóriumába kerültek, ahol –80 °C-on voltak tárolva a molekuláris diagnosztikai vizsgálatokig.

Virális nukleinsav kivonása a székletmintákból

A kiindulási székletminták székletszuszpenziók voltak 10–50%-os PBS hígításban, melyeket egyszer, egyenlõ mennyiségû Genetronnal (1,1,2–trikloro-1,2,2-trifluoroetán, Freon-113, Serva) extraháltunk. A szobahõmérsékleten végzett centrifugálás (5 perc, 10 000 Xg, Jouan CR3I centrifuga) után a felülúszóból a virális RNS kinyerése Trizol Gibco (Gibco, BRL, Gaithersburg, MD, USA) eljárás alapján történt a gyártó leírása szerint. A részlegesen tisztított vizes fázist Trizol Reagenssel (Gibco BRL, Life Technologies, Grand Island, USA) és kloroformmal (Reanal, Budapest) 5 percig inkubáltuk, majd 15 percig 10 000 Xg-vel centrifugáltuk 4 °C-on. A felülúszóból az RNS precipitálását izopropanollal (Reanal, Budapest) végeztük, és a precipitátumot 10 percig a fenti centrifugálási körülmények mellett ülepítettük. A kicsapott RNS-t egyszer 75%-os etanollal mostuk. A kinyert RNS-t szárítás után 20 µl nukleázmentes vízben feloldva (Nuclease-Free Water, Promega, USA) azonnal felhasználtuk.

Primerek

Az RT–PCR amplifikációhoz felhasznált primereket Jiang és mtsai a NLV- és SLV-ok genetikai állományából az RNS-dependens RNS polimerázt kódoló gén konzervatív régiójára tervezték, és közleményükben a p289 és p290 jelû primerek szekvenciáját meg is adták (7). A primer 289:5’ – TGACAATGTAATCATCACCAT sense és primer 290:5’ – GATTACTCCAAGTGGGACTCCAC antisense oligonukleotidokat az Integrated DNA Technologies Inc.-nél (Coralville, USA) szintetizáltattuk. Az amplifikált termék NLV esetén 319, SLV esetén pedig 331 bázispár nagyságú (7).

Reverz transzkripció-polimeráz láncreakció (RT–PCR)

A reverz transzkripció egy mintájának 50,6 µl-ében 3 µl RNS mintát használtunk fel. Az RT-keverék a következõ alkotórészeket tartalmazta: 10 U/µl AMV Reverse Transcriptase (Promega, Madison, USA), 10X PCR puffer [100 mM Tris–HCl (pH: 8,3); 15 mM MgCl2, 500 mM KCl, 0,01% gelatin; Sigma, Saint Louis, USA], 25 mM MgCl2 (Zenon Biotechnológia Kft., Szeged), 10 mM dNTP (Promega, Madison, USA), 40 U/µl RNasin (Promega, Madison, USA) és 0,1 µg/µl primer 289. Az RT inkubáció 42 °C-on, 60 percig zajlott PTC–100TM készülékben (PTC–100TM, Programmable Thermal Controller, MJ Research, Inc., Watertown, USA). A polimeráz láncreakció 50 µl elegye a következõ kiindulási anyagokat tartalmazta: 10X PCR puffer, 25 mM MgCl2, 5 U/µl DNS polimeráz (Dupl-A-TaQTM DNS Polimeráz, Zenon Biotechnológia Kft., Szeged) és 0,1 µg/µl primer 290. A PCR amplifikációs programban a denaturáció 94 °C-on (3 perc) zajlott, és 40 ciklusból álló polimeráz láncreakciót végeztünk. Mindegyik ciklus egy 94 °C-os 1 perces, majd 37 °C-os 2 perces, és egy 72 °C-os 1 perces szakaszból állt. A végsõ extenzió 72 °C-on 10 percig tartott. Negatív kontrollként 3 µl nukleázmentes vizet használtunk (Nuclease-Free Water, Promega, Madison, USA). Az amplikont 1,5%-os agaróz gélben vizsgáltuk (NuSieve 3:1 Agarose, FMC BioProducts, USA) Tris-Borát-EDTA puffert alkalmazva (pH: 8,0), etidium-bromid festéssel és 320 nm UV-átvilágítással. A gélrõl DS 34 Polaroid kamerával Polaroid 660 típusú fekete–fehér filmre készítettünk felvételt. Az elektroforézisnél DNS-markert alkalmaztunk (100 bp DNA Ladder, Promega, Madison, USA), és az amplikonok méretét BioCapt (Version 97.05s for Windows, 1997) számítógépes program segítségével analizáltuk.

Eredmények

Az epidemiológiai vizsgálat feltárta, hogy a Szegeden és Algyõn 1998. november 25. és 28. között 4 nap alatt lezajlott gastroenteritis-járvány összesen 80 embert érintett. Hetvenkét gyermek és 8 felnõtt betegedett meg egy szegedi óvodában, egy algyõi óvoda és egy általános iskola alsó tagozatában, akik ugyanazon gyanúba került cég konyhájáról étkeztek. A 3 intézményben 340 gyermek és 88 felnõtt részére tálaltak, de a betegek csak az egyik menüt fogyasztók között voltak. A klinikai tünetek 1998. november 25-én késõ este, illetve éjfél körül kezdõdtek. Másnap a háziorvosoknál 70, november 27-én még 10 ember jelentkezett gastroenteritises tünetekkel a 3, egymástól távoli intézménybõl. A járvány során jelentkezett szimptómák gyakoriság szerint a következõk voltak: vezetõ tünetként a hányást jelentették, de sokan panaszkodtak hasi fájdalomra is. Az esetek egy részében hasmenés, hõemelkedés és láz is társult. A betegség lefolyása rövid volt, 1–2 napig tartott. Kórházi felvételre nem került sor. Az ételminták szokásos mikrobiológiai vizsgálata negatív eredménnyel zárult. A bakteriológiai szûrõvizsgálatra kötelezett 49 dolgozó széklete ugyancsak negatív volt. A betegek közül 51 fõnél történt székletvizsgálat, ebbõl 3 esetben Campylobacter tenyészett ki (Campylobacter jejuni – 1 eset, Campylobacter lari – 2 eset). Vizsgálati anyagként 5 különbözõ személytõl vett egyszeri székletmintán kívül más minta nem állt rendelkezésünkre calicivírus-kimutatásra. Az általunk vizsgált székletminták 3–5 éves kor közötti 2 fiú- és 3 lánygyermektõl származtak (a két fiú szegedi testvérpár, a lányok között két algyõi és egy szegedi kisgyermek volt). Náluk az elõzetes mikrobiológiai vizsgálatokkal sem bakteriális kórokozókat (Salmonella, Shigella, E. coli, Yersinia enterocolitica, Campylobacter, Staphylococcus aureus), sem rota- (SDS–PAGE), adeno- (Latex-aggl.) vagy enterovírust (tenyésztés) nem lehetett kimutatni. Ezeket a vizsgálatokat az ÁNTSZ Csongrád Megyei Intézete mikrobiológiai laboratóriumaiban végezték el. A székletmintákból elõzetesen EM-vizsgálat calicivírus kimutatására nem történt.

Ugyanakkor az RT–PCR módszerrel, az alkalmazott p289/p290 primerpárral vizsgálva mind az öt székletminta (100%) humán calicivírust tartalmazott. A 2. ábra az amplifikált termékeket mutatja agaróz gélelektroforézis után, festést és UV-átvilágítást követõen. A kapott termékek mind az 5 székletmintából a 300–400 bázispár (bp) között, azonos magasságban helyezkednek el, és méréssel 319 bp nagyságúnak bizonyultak.
 
2. ábra: Humán calicivírus kimutatása RT-PCR módszerrel székletmintából 

Az RNS extrakció Trizol Gibco, az amplifikáció RT-PCR eljárás szerint történt. 1. pozíció: DNS-marker (100bp DNA Ladder, Promega, Madison, USA). 100, 300, 500, 1500 bázispár (bp) méretek az ábra bal szélén jelölve, 2.-6. pozíció: öt székletmintából calicivírusra specifikus primerrel (p289/p290) kapott PCR termék, ugyanazon járványból, 7. pozíció: negatív kontroll. Az amplifikált termékeket agaróz gélelektroforézis és etidium-bromid festés után UV-fénnyel tettük láthatóvá 

Megbeszélés

A Szegeden és Algyõn 1998 novemberében lezajlott gastroenteritis-esethalmozódás epidemiológiai háttere, klinikai tünettana megfelelt a HuCV-fertõzés elõzetes diagnosztikai kritériumainak (6). A HuCV oki szerepét valószínûsítette az is, hogy hagyományos bakteriológiai és virológiai vizsgálatokkal kórokozót nem tudtunk kimutatni. A járvány megnyugtató, végleges lezárására és a valódi etiológiai diagnózisra egy évvel késõbb került sor, amikor a HuCV-t az 1999-ben publikált „leguniverzálisabb” p289/p290 primerpár alkalmazásával, reverz transzkripció-polimeráz láncreakció módszer segítségével mutattuk ki (7). A primerpár 25-féle HuCV RNS-polimerázt kódoló konzervatív régiója alapján Jiang és mtsai által megtervezett oligonukleotid, mely 11-féle HuCV genetikai klasztert és általánosan elterjedt alapprototípust reprezentál a NLV és a SLV nemzetségekbõl (7). A kapott eredmény alapján a Szegeden és Algyõn 1998. novemberében lezajlott gastroenteritis-járványt ugyanaz a vírustípus okozta, mely nagy valószínûséggel a Norwalk-szerû vírusok közé tartozhat az amplikon méretét tekintve. A kórokozó pontos besorolását a szekvenciaadatok fogják majd eldönteni. Munkánk során csak a rendelkezésünkre álló székletmintákból igazoltuk a HuCV jelenlétét, bár a módszer alkalmas a vírus ételbõl, vízbõl való kimutatására is. Így csak feltételezhetõ, hogy a fertõzés forrása a kontaminált étel lehetett, melyet alátámaszt az, hogy a betegek csak az egyik menüt fogyasztók körébõl kerültek ki. Eredményeink birtokában a kitenyészett bakteriális kórokozók valószínûleg az 1 hónappal korábban ugyanazon szegedi óvodában lezajlott Campylobacter-fertõzés „tünetmentes” hordozói lehettek.

Tíz évvel ezelõtt a HuCV-okat csak EM-os vizsgálattal, és önkéntesek mesterséges vírusfertõzésével nyert diagnosztikumokon alapuló szerológiai tesztekkel lehetett kimutatni. Így viszont az eseteknek csak kb. 20%-ában sikerült a HuCV-ok oki szerepét a fertõzésekben bizonyítani (4). Ma az RT–PCR eljárással ez eléri a 91–96%-ot (4). A módszer nemcsak a szenzitivitást, hanem a specificitást is növeli (4, 10). Ugyanakkor a specificitás az RT–PCR módszerben függ a primer szekvenciájától (8). A calicivírusok nagy genetikai diverzitása miatt jelenleg még nem lehet egy általános, a HuCV-ok minden tagjának kimutatására alkalmas primerpárt alkalmazni, hiszen az eltérõ vírustörzsek száma állandóan nõ. Nagyobb az esély akkor, ha ismerjük akár csak földrajzi elõfordulásuk szerint is a különbözõ vírustörzseket és feltérképezve genetikai állományuk konzervatív régióit, ezek alapján alkalmazunk „univerzális” primert a PCR vizsgálatokhoz.

Hazánkban és – ismereteink szerint – a kelet-európai régióban elsõként sikerült molekuláris módszerekkel humán calicivírust kimutatni és leírni. Szeretnénk a jövõben elérni, hogy az általunk Magyarországon kimutatott HuCV-ok szekvenciarokonságát és genomorganizációjának összehasonlító vizsgálatait, filogenetikai analízisét is el tudjuk végezni. A vírusok genetikai állományának pontosabb megismerésével hozzájárulhatunk majd újabb, érzékenyebb, specifikusabb és szélesebb körben használható primerek tervezéséhez a HuCV-ok okozta virális gastroenteritisek sikeresebb diagnosztikája érdekében.

Köszönetnyilvánítás: Köszönettel tartozunk David O. Matsonnak, Xi Jiangnak, Farkas Tibornak és Berke Tamásnak (Center for Pediatric Research, Norfolk, Virginia, USA), akiknek tanácsai és a p289/p290 primer-szekvenciák publikáció elõtti átengedése nélkül vizsgálataink nem, vagy csak nehezen jártak volna sikerrel.

IRODALOM:

  1. Ando, T., Jin, Q., Gentsch, J. R. és mtsai: Epidemiologic applications of novel molecular methods to detect and differentiate small round structured viruses (Norwalk-like viruses). J. Med. Virol., 1995, 47, 145–152.
  2. Cubitt, W. D., Bradley, D., Carter, M. és mtsai: Caliciviridae. In „Classification and nomenclature of viruses”. Sixth report of the International Committee on the Taxonomy of viruses. Arch. Virol. Suppl., 1995, 10, 359–363.
  3. Dedman, D., Laurichesse, H., Caul, E. O. és mtsa: Surveillance of small round structured virus (SRSV) infection in England and Wales, 1990-5. Epidemiol. Infect., 1998, 121, 139–149.
  4. Fankhauser, R. L., Noel, J. S., Monroe, S. S. és mtsai: Molecular epidemiology of „Norwalk-like viruses” in outbreaks of gastroenteritis in the United States. J. Infect. Dis., 1998, 178, 1571–1578.
  5. Green, K. Y., Ando, T., Balayan, M. S. és mtsai: Taxonomy of the caliciviruses. International workshop on human caliciviruses, 1999, CDC, Atlanta
  6. Hedberg, G. W., Osterholm, M. T.: Outbreaks of food-borne and waterborne viral gastroenteritis. Clin. Microbiol. Rev., 1993, 6, 199–210.
  7. Jiang, X., Huang, P. W., Zhong, W. M. és mtsai: Design and evaluation of a primer pair that detects both Norwalk- and Sapporo-like caliciviruses by RT–PCR. J. Virol. Meth., 1999, 83, 145–154.
  8. Jiang, X., Matson, D. O.: Detection of human caliciviruses and astroviruses in stools by RT–PCR. Meth. Molec. Med. Diagnostic Virology Protocols, 1997, 12, 19–27.
  9. Jiang, X., Matson, D. O., Velazqeez, F. R. és mtsai: Study of Norwalk-related viruses in Mexican children. J. Med. Virol., 1995, 47, 309–316.
  10. Jiang, X., Wang, J., Graham, D. Y. és mtsa: Detection of Norwalk virus in stool by polymerase chain reaction. J. Clin. Microbiol., 1992, 30, 2529–2534.
  11. Maguire, A. J., Green, J., Brown, D. W. G. és mtsai: Molecular epidemiology of outbreaks of gastroenteritis associated with small round-structured viruses in East Anglia, United Kingdom, during the 1996–1997 season. J. Clin. Microbiol., 1999, 37, 81–89.
  12. Pelosi, E., Lambden, P. R., Caul, E. O. és mtsai: The seroepidemiology of genogroup 1 and genogroup 2 Norwalk-like viruses in Italy. J. Med. Virol., 1999, 58, 93–99.
  13. Seah, E. L., Gunesekne, I. C., Wright, P. J.: Variation in genogroup 2 Norwalk-like viruses. Arch. Virol., 1999, 144, 1007–1014.
  14. Szûcs Gy., Új M.: Calicivírusok bennünk és körülöttünk. Magyar Állatorvosok Lapja, 1998, 11, 659–662.
  15. Wang, J., Jiang, X., Madore, H. P. és mtsai: Sequence diversity of small, round-structured viruses in the Norwalk virus group. J. Virol., 1994, 68, 5982–5990.
(Reuter Gábor dr., Pécs, Szabadság út 7. 7623)

Vissza az elejére